"THE CASE AGAINST EVOLUTION" ARTICLE CONTENTS:
Introduction
Getting Acquainted with the Issue
Defining Evolution
What is a “Kind”?
What is Science?
Evolution is Belief-Based
Evolution is Useless to Science
What Are the Facts?
The Emperor’s New Clothes
Theological Problems
No Death Before the Fall of Man
Fall of Man was Necessary for Christ’s Atonement
Evolution Forces us to Doubt the Scriptures
Compromising Adam
Biological Sciences
Mutations
Similar Structures
Vestigial Structures
The So-Called Mitochondrial Eve
Age of the Earth and the Flood
The Contents of the Ark
The Geologic Column
The Answer: Liquefaction
Cave Formation
Fossil Formation
Grand Canyon
Diamonds
The Helium Escape Problem
Human Artifacts in Solid Coal
Continental Erosion
The Ocean Salt Problem
Carbon/Radiometric Dating
Absence of Intermediate Forms in Fossils
Archaeopteryx
Cave Men and Other Monkey Business
Dinosaurs
Conclusion
The Case Against Evolution
By Loyal to the Word
Evolution has long been a source of trouble and confusion for members of The Church of Jesus Christ of Latter-day Saints and Christians in general. Especially now since evolutionary theory is the prevailing view for the origin of life and the universe as taught by schools and those purporting to be the advocates of science. Must Latter-day Saints accept this popular view, or is there a viable alternative? Is there any harm in accepting evolutionary theory and trying to synthesize it into the gospel? Is this really a case of science versus religion, or is that an inaccurate way to describe the issue?
This paper is critical of the claims of evolutionary theory in general and in its relation to the Restored Gospel of Jesus Christ. It is the author’s sincere endeavor to present a view that is compatible with the scriptures. Evolution is herein examined from both a theological and a scientific perspective. Spending undue time quarrelling with the various false gospel/evolution compromise theories is not the purpose of this author. It is his purpose to present the plain meaning of the scriptures, discuss the science supporting them, and allow the readers to make their judgment. A detailed examination of all the spurious compromise theories would not be possible in this article, as they are innumerable. But a criticism of their common elements will be made.
The views and conclusions of this paper represent the author’s understanding of the gospel as acquired through study of the scriptures and the teachings of the Prophet Joseph Smith. The intent of the author is to disabuse the minds of curious and well-meaning Latter-day Saints who are confused regarding their indoctrination of evolution from their secular schooling.
getting acquainted with the issue
Defining Evolution
Before a discussion about evolution should commence, it is important to define what is being talked about. There are two types of biological “evolution”:
Microevolution: this is simply variation and diversity found among the different kinds of animals;[1] e.g.: big dogs and little dogs, or bacteria becoming antibiotic resistant bacteria. Microevolution produces great variety among creatures. Nobody is arguing about this. It happens and is an observable fact.
Macroevolution: this is the idea of animals evolving into a completely different kind of animal.[2] E.g.: from monkey to man, or from dinosaur to bird. Macroevolution has never been observed;[3] it must be believed in.
[1] Sylvia S. Mader, Inquiry into Life, 10th ed., (
[2] Neil A.
A hypothetical diagram illustrating the difference between microevolution and macroevolution. Microevolution produces variety and is observable. Macroevolution is a change of a certain kind of animal into a completely different kind. It is based on nothing more than wishful thinking. It has never been observed.

Evolutionists constantly try to prove macroevolution true by citing examples of microevolution. It is actually quite an underhanded deception, because they never offer direct evidence of macroevolution, only examples of microevolution, and then act as though macroevolution is thereby proved. If the reader finds this maneuver being pulled on them, just stop and think, “Okay, wait a minute,” and then listen very carefully to what is being said. The reader should be aware that this form of reasoning by evolutionists displays the argument fallacy of equivocation, in which the word “evolution” is used in two different senses. Like
From here on, whenever this paper refers to “evolution,” it will be referring specifically to macroevolution.
What is a “Kind”?
The scriptures tell us positively that forms of life will bring forth “after their kind.”[1] This is repeated so much in the beginning of the Creation narratives that it makes no sense to suggest that there is room for disagreement on this point.
And I, God, said: Let the earth bring forth grass, the herb yielding seed, the fruit tree yielding fruit, after his kind…And I, God, created the great whales, and every living creature that moveth, which the waters brought forth abundantly, after their kind, and every winged fowl after his kind…And I, God, said: Let the earth bring forth the living creature after his kind, cattle, and creeping things, and beasts of the earth after their kind, and it was so.[2]
This is exactly opposite to evolution, which teaches that life started out simple and primitive and gradually diversified into all the present varieties. In fact, it is crucial to the theory of evolution that things must not bring forth after their kind only.
What is a kind? If animals can procreate together and produce offspring, they are probably of the same kind. For instance, wolves would certainly be part of the dog kind. After all, wolves can interbreed with dogs and anyone can tell that they are the same kind of animal. Many make the mistake of equating a “species” with the scriptural “kind,” but there is no indication that the two are necessarily analogous. Animals can be of a different species and yet be of the same kind, so do not fall into that trap. Throughout this paper, when “kinds” of animals are referred to, it will be in this scriptural sense.
Nature bears us the same witness as scripture, since there has never been a recorded incidence of macroevolution. Living things always bring forth after their kind. For example, dogs produce a wide variety of phenotypes (physical characteristics): like big, small, long, or short-haired dogs. But no amount of dog breeding has ever produced offspring that was anything other than a dog.[3] We also have word from the Prophet Joseph Smith, in no uncertain terms, that it is impossible for life to come forth except after its own kind. He said:
God has made certain decrees which are fixed and immovable; for instance, God set the sun, the moon, and the stars in the heavens, and gave them their laws, conditions and bounds, which they cannot pass, except by His commandments; they all move in perfect harmony in their sphere and order, and are as lights, wonders and signs unto us. The sea also has its bounds which it cannot pass. God has set many signs on the earth, as well as in the heavens; for instance, the oak of the forest, the fruit of the tree, the herb of the field, all bear a sign that seed hath been planted there; for it is a decree of the Lord that every tree, plant, and herb bearing seed should bring forth of its kind, and cannot come forth after any other law or principle.[4]
Of course, according to the theory of evolution, all plants and animals are ultimately related to each other; every plant and animal can trace their lineage back, through millions of years, to a single-celled organism when life began. But here we find the Prophet making it clear that plants have never had relation to animals. There can be no reconciliation between these two views.

Representatives of the Dog kind. Dogs are capable of producing a variety of phenotypes (characteristics). This is an excellent example of microevolution, which is simply variation within a kind of animal.
What is Science?
Science means literally, “knowledge” and comes from the Latin word meaning “to know.” It is a “systematized knowledge derived from observation, study, and experimentation.”[1] It is things that can be observed and demonstrated through repeatable experimentation. What most readers will find amazing is that evolution is not part of science, because it cannot actually meet this criterion. Science must be repeatable. No experimental test can be designed in a laboratory setting to duplicate a process of evolution from a single-celled organism into a human being. If a process cannot be repeated then it cannot be scientifically verified. No amount of observation, study, experimentation, or demonstration has shown that creatures can evolve into different kinds of creatures, or that life evolved billions of years ago. These are notions that must be taken on the basis of belief.
Furthermore, science must be falsifiable.[2] In other words, concepts that are presumed to be scientific must be subject to experimentation that could establish their veracity; they must be able to be proved wrong if they are untrue. The famous science philosopher, Karl Popper said:
I have come to the conclusion that Darwinism is not a testable scientific theory but a metaphysical research programme – a possible framework for testable scientific theories.[3]
Something is not falsifiable when a person can continually find an escape hatch for every objection to their theory. This is the case with evolution. No matter what great arguments exist and will exist that invalidate evolution, the theory will always survive them because its proponents will appeal to “just so” circumstances that might have made evolution possible. Alex Fraser, a Professor of Genetics at the University of California, concurred with this and Popper’s sentiment at a symposium:
It would seem to me that there have been endless statements made and the only thing I have clearly agreed with through the whole day has been the statement made by Carl [sic] Popper, namely, that the real inadequacy of evolution, esthetically and scientifically, is that you can explain anything you want by changing your variables around.[4]
Simply put, evolution constitutes a belief system and is not part of science. If a person has a belief about something they absolutely cannot verify, they probably will not call it “science,” although they might consider it to be a religious thought. It is the same thing with evolution – it is ultimately beyond the verification of science. There is no way to falsify or establish beyond reasonable scientific doubt a one-time, non-repeatable past event like the evolution story. In the end it is belief that is the basis for evolution theory, and this is true for the most intelligent minds to the basest of intellects. Based on this understanding, it seems inappropriate to label evolution as “science.”
Surely detractors to this paper will criticize its author for being “anti-science.” This criticism will come from the minds of people who, because of evolutionist indoctrination, are completely unable to separate evolution from science. These are the people who, though some even be of our same faith, will fight against the truths of the Creation in a misguided attempt to defend science and reason. They have been trained all their lives through secularism to think that science and evolution are the same. This is a fatal fallacy in thinking which must be overcome if any person desires to see the truth.
Evolution is Belief-Based
Evolutionists and the erring popular media like to present the evolution vs. creation controversy as “science vs. religion.” But the issue is not science vs. religion; it is religion vs. religion, or ideology vs. ideology. Science has its role for sure, on both sides. But both creationists and evolutionists are exercising belief in order to subscribe to their respective ideas.
Evolution falls outside of the realm of science. You must believe that all life has evolved from a single-celled organism; there is no way to verify such a notion (short of hopping into a time machine and going back to videotape the process). Any theory or idea about the origin of life must be relegated to the realm of belief, and nothing more.
Evolution is actually a religion, because it must be believed in; it cannot be verified. And it provides its subscriber with answers to the same questions that religion is supposed to solve: It provides him or her with a unique, belief-based self-identity (i.e. that they are related to plants and animals) and a world-view of history and the earth (i.e. millions years of evolution). In addition to this, evolutionary theory also gives insights into what mankind’s conduct ought to follow (people are animals, after all), their relationship to God (hey, maybe there isn’t one – there need not be) and man’s ultimate destiny (when a person dies, that is the end).
Certainly evolution is evangelized with religious zeal by many of its adherents, to the point of indoctrination attempts via the public school system, and marginalization of those who do not subscribe. They are like the false priests of the dark ages, lashing out at “heresy” against the established order and intellectually burning others at the stake like the apostate church of old. It is also interesting to observe the emotional reactions that arise from one who is on the defensive about evolution. They are the same kind of emotions that surface when people defend deeply cherished beliefs, like religious beliefs. Evolution is clearly a sort of secular religion, that is, a belief-system completely unconcerned with spirituality or morality. The logical conclusion of atheistic evolution is humanism; as we shall see later, the result of theistic evolution is confusion.
Evolution is Useless to Science
Evolutionists like to contend that any criticism of their theory is tantamount to reverting to the dark ages of religious control over scientific thought. In reality, it is the evolutionists’ tight control over the voicing of counter opinions that resembles the suppression of information so reminiscent of the dark ages. What many are afraid of is that science will suffer if we do not accept the theory of evolution. This is based on a mistaken idea.
In reality, the idea that man came from apes, or that all life evolved from a single-celled organism, is not helpful to the advancement of science. Such an idea has no significant relation to technology advancement or any other useful branch of thought. There are many evolutionists that will claim that such an idea is vital in understanding how viruses and micro-organisms mutate, and thus they will claim that the theory of common descent helps us fight disease. But this argument is completely fallacious, since mutations of micro-organisms is simply an example of microevolution, not macroevolution. In each case, there are genetic limits to the mutations. Therefore an understanding of microevolution, not macroevolution, is important in such cases. Macroevolution is not even part of the equation (unless a person forcefully makes it part of the equation because they believe that that is how life came to be).
Often credit is given to evolution for things which could just as easily be attributed to Design. An evolutionist will say that evolution gave us the powers of sight, hearing, and speech as well as opposable thumbs. They give the credit for such things to the unverified, belief-based process of evolution, rather than to God - the Creator. As the scriptures say, they have thereby “changed the truth of God into a lie, and worshipped and served the creature more than the Creator” (Rom. 1:25). Any intelligent person, rather than attributing every clever or ingenious aspect of Creation to a purposeless random process over a long stretch of time, could in each case conclude, “It was designed to be that way.” Evolutionists usually see the world through nothing except evolution, and therefore they develop tunnel vision when considering why things were made they way they were. Even the theistic evolutionists for some reason cannot seem to imagine God purposefully designing things like primal instincts, immune systems, or opposable thumbs. Reason cries out to make us consider an obvious possibility – living things are structured they way they are and behave the way they do because that is how they were originally designed.
The theory of evolution is not only useless but can actually be a hindrance to the advancement of science in some cases. For instance, evolution teaches that since organisms are constantly evolving, there are useless vestigial structures to be found in the body. They assume that, since creatures evolved, and we don’t currently understand the function of such and such bodily organ, it must be a useless vestige, a relic of our evolutionary past. This has been the story over and over again, when in reality structures long-thought to be vestigial actually had a function that was not yet discovered. Evolution was holding science back by dismissing such structures as vestigial. Someone who believes in a Divine Creator, however, might properly conclude that there is probably a function to every organ since it was created with a purpose. This attitude would have led to the discovery of the organ’s function much sooner.
What Are the Facts?
Most evolutionists, because of their indoctrination, are astonishingly incapable of separating in their minds the facts from interpretations of the facts. To illustrate, it is a fact that fossils exist. This is observable and testable. We could take a car ride together and go to a museum or dig site and see the fossils. They exist, and that is a fact. The idea that they are millions of years old is an interpretation of that fact, not a fact in and of itself. It is someone’s viewpoint of the fact at hand, and is not in itself a fact that is beyond dispute, as though it were an immutable law of the universe.
Likewise, it is a fact that fossils are sorted into layers throughout the earth. But the idea that the fossils in higher layers evolved from fossils in lower layers is an interpretation of the fact at hand, and is not a fact in and of itself. How do we know that, simply because fossils are stacked on top of each other, the ones on the bottom are the ancestors of the ones on the top? We do not, and cannot know that scientifically. Evolutionists can only assume or believe that. However credible they may feel that belief or assumption is, it is still only that – a belief or assumption, and not a fact.
A favorite trick of evolutionists to spread their dogma is to confuse the facts with their interpretations of the facts. They will claim that their speculations of facts are themselves factual merely by being associated with the facts being studied. Next time an evolutionist makes a claim about “evolutionary history” and expects it to be considered factual, think carefully about which portion is actually fact, and which is the evolutionist’s mere interpretation of the fact. There is a whole world of difference.
The Emperor’s New Clothes
Hans Christian Andersen’s tale, The Emperor’s New Clothes is a story about a large mass of people falling prey to the manipulation of clever swindlers and subscribing to a belief that they otherwise would not hold, were it not for the social pressures involved. In the story, the swindlers convinced the Emperor that they had made him a remarkable set of clothing that could only be seen by exceptional people. They likewise told him that anyone who could not see his special new clothes was therefore too stupid or unfit to behold them. Of course, the Emperor had been tricked, and he was actually wearing no clothes at all. Yet everyone fell in line and praised the Emperor for his beautiful clothing, for fear of being labeled stupid or unfit for kingly grandeur.
The reader may have heard statements to the effect that “Evolution is the unifying theme that unites all biology,” or other mantras that try to make it seem as though evolution is indistinguishable from and indispensable to, science. These pronouncements are given with such confidence that the hearer dares not to question it. Anyone who would dare defy such pronouncements must be stupid, according to the evolutionists; either that or they do not understand science. But the idea of evolution being fundamental or necessary to science is absolutely false. The only thing evolution is fundamental for is furnishing a particular worldview, a lens through which to see the world.
Evolutionists would have you believe that their theory is more reasonable than Intelligent Creation. However, as we shall see, they have things exactly backwards. Like the Emperor in the story, they simply have nothing to show for in reality, and can be exposed for their nakedness by reasonable thinking. It is not more reasonable to believe in evolution, and belief in it is not the objective conclusion of science.
Is evolution really important to understanding life scientifically? No. In reality, it is not necessary to know how a cell, an animal, or a thing ultimately came to be in order to understand its operation and purpose. Furthermore, evolution does not give us an answer to how living things came to be, anyway. To suggest that living things could arrive by chance is absolutely unreasonable. Naturalistic explanations do not even come close to explaining the origin of life. Admissions such as this one from the periodical Interdisciplinary Science Reviews are typical of the problem associated with spontaneous generation:
More than 30 years of experimentation on the origin of life in the fields of chemical and molecular evolution have led to a better perception of the immensity of the problem of the origin of life on earth rather than to its solution. At present all discussions on principal theories and experiments in the field either end in a stalemate or in confession of ignorance.[5]
The theory of evolution proposes that the first single-celled organism evolved in a primordial soup billions of years ago. The probability of this happening is too wild for serious consideration. The probability of accidentally forming a single biopolymer necessary for life is about the same probability as “1050 blind persons, each with a scrambled Rubik cube…simultaneously arriving at the solved form.”[6] Of course, even if such a thing were accomplished, that still would be a very far cry from a complete, functional cell. Many proteins, which are biopolymers, are required to successfully maintain a cell, since “Proteins account for more than 50% of the dry mass of most cells, and they are instrumental in almost everything organisms do.”[7]
The suggestion that the world and its creatures came about without any supernatural creation is known as naturalism, and is synonymous with atheistic evolution. It is truly ironic that this “naturalistic” view of origins breaches the known natural laws of science from step one! Right from the very beginning, evolution runs into scientific problems, as its naturalistic explanation of life is completely insufficient. This admission from the Journal of Theoretical Biology displays the problem:
…the longest genome which could be expected with 95% confidence in 109 years corresponds to only 49 amino acid residues. This is much too short to code a living system so evolution to higher forms could not get started. Geological evidence for the ‘little warm pond’ is missing. It is concluded that belief in currently accepted scenarios of spontaneous biogenesis is based on faith, contrary to conventional wisdom.[8]
It would be easier to believe in evolution if life on the cellular level were as simple as was thought in Darwin’s day. Ernst Haeckel, an influential supporter of Darwin in the 19th century, was sure that a biotic cell was a “simple little lump of albuminous combination of carbon,”[9] and a “homogeneous globule of protoplasm.”[10] But nothing could be further from the truth. Cells are extremely complex and highly organized. They are like amazing, super-efficient little factories, with numerous little parts working together in complex operations, and with each component seeming to understand and comprehend its purpose. To make matters worse for the believer in chance, the cell is organized such that it is “irreducibly complex,” which means that all of its components are necessary in order for the entire thing to work and “the removal of any one of the parts causes the system to effectively cease functioning.”[11] The atheistic evolutionist must believe in a great miracle: that a functional cell could arise from soupy mud with all its various and complex parts in perfect organization and working order.
Theological problems
No Death before the Fall of Man
There are also serious theological reasons to reject evolutionary theory. Evolution is entirely incompatible with the Gospel of Jesus Christ. Firstly, there is the matter of the timing of when death was supposed to have entered into the world. According to evolution, death has always existed on our planet; indeed, according to this thinking, death was an essential part of the mechanism which brought mankind forth. But the scriptures tell us positively and without a doubt that there was no death before the Fall of Man. Adam caused death to enter into the world when he partook of the forbidden fruit:
“And [Enoch] said unto them: Because that Adam fell, we are; and by his fall came death; and we are made partakers of misery and woe.”[12]
“Wherefore, as by one man sin entered into the world, and death by sin… Nevertheless death reigned from Adam to Moses… by one man's offence death reigned.”[13]
“by reason of transgression cometh the fall, which fall bringeth death”[14]
“And now, behold, if Adam had not transgressed he would not have fallen, but he would have remained in the garden of Eden. And all things which were created must have remained in the same state in which they were after they were created; and they must have remained forever, and had no end.”[15]
“the fall had brought upon all mankind a spiritual death as well as a temporal”[16]
“For since by man [Adam] came death…”[17]
The scriptures do not associate the entrance of death into the world with any figure other than Adam. But an evolutionist must, out of necessity, deny this truth! For evolution teaches that organisms have been living and dying for millions of years before man ever appeared on earth! Evolutionists within the Church are no exception; the staunch ones would sooner believe an unverified theory than believe the scriptures as they reiterate this point over and over. We shall soon see why believing there was death prior to Adam is such an uncomfortable compromise for a Latter-day Saint; not just uncomfortable, but destructive.
Another striking inconsistency that deserves mention here is the fact that the Fall had dual consequences: it brought both death and sin.[18] Therefore, if death was already in the world the whole time, then that means sin was, too. This would mean that Adam and Eve already knew sin and that the whole eating of the forbidden fruit episode was perfectly meaningless!
Fall of Man Was Necessary for Christ’s Atonement
The most disturbing aspect of the theory of evolution is that it completely nullifies the need for the Atonement of Jesus Christ. This is simply because if death has been operating in the world before man came to it, then there was no Fall of Man. Yet Christ came to earth specifically to remedy it from the effects of sin and death commenced by the Fall. If there was no Fall of Man, then why did Christ come? This is the major point that no LDS evolutionist can reconcile in a believable way. The scriptures tell us that the Fall of Adam was the whole reason the Atonement occurred:
“the resurrection must needs come unto man by reason of the fall”[19]
“Behold, [God] created Adam, and by Adam came the fall of man. And because of the fall of man came Jesus Christ, even the Father and the Son; and because of Jesus Christ came the redemption of man.”[20]
“For behold, and also [Christ’s] blood atoneth for the sins of those who have fallen by the transgression of Adam”[21]
The scriptures further tell us that there is an important, reciprocal relationship between the Fall and the Atonement, insomuch that they cannot be separated from each other:
“For since by man came death, by man came also the resurrection of the dead. For as in Adam all die, even so in Christ shall all be made alive.”[22]
Latter-day Saints who compromise their beliefs to accommodate evolutionary theory have a major problem with the scenario the above scripture presents. That is because they necessarily cannot believe the first premise, that is, the part about Adam bringing death into the world. Evolutionary theory will not allow it, for according to the theory, death has reigned on the earth for millions of years prior to man’s appearance! The critical problem remains for all gospel/evolution compromisers: If a person cannot trust the first part of this statement (“by man came death… in Adam all die”), then how can they trust the latter part of the statement (“even so in Christ shall all be made alive”)?
Put very simply, if there was no Fall of Man, then there was certainly no Atonement made in response to it. They must go together. This idea of the Fall and the Atonement being critically linked together is not an isolated scriptural passage or two. It is spans throughout the entire scriptures as a running theme, a foundation to the whole gospel story. For instance, readers are met with the same doctrine elsewhere in the New Testament:
Wherefore, as by one man sin entered into the world, and death by sin; and so death passed upon all men, for that all have sinned:
(For until the law sin was in the world: but sin is not imputed when there is no law.
Nevertheless death reigned from Adam to Moses, even over them that had not sinned after the similitude of Adam's transgression, who is the figure of him that was to come.
But not as the offence, so also is the free gift. For if through the offence of one many be dead, much more the grace of God, and the gift by grace, which is by one man, Jesus Christ, hath abounded unto many.
And not as it was by one that sinned, so is the gift: for the judgment was by one to condemnation, but the free gift is of many offences unto justification.
For if by one man's offence death reigned by one; much more they which receive abundance of grace and of the gift of righteousness shall reign in life by one, Jesus Christ.)[23]
The message is consistent: Adam bringing death into the world is a necessary condition for Christ to come into the world, just as surely as Christ’s Atonement will save us from the Fall. And the relationship between the Fall and the Atonement is fundamental and inseparable.
Evolution Forces Us to Doubt the Scriptures
Evolutionists within the Church pay a terrible price to satisfy their misguided intellectual ego. Belief in the theory of evolution requires disbelief in the many scriptural passages that seem intended to be taken at face value. This includes all of the scriptures quoted above relating to the Fall of Man. LDS evolutionists are willing to take the phrase, “in Christ shall all be made alive,” literally, but on the other hand, they are unwilling to accept its necessary condition, “as in Adam all die,” as being literal. This is a slippery slope. Exactly at what point does a person begin to trust the scriptures? If games keep being played with the meaning of the scriptures like this, how hard would it be to convince oneself that the statement, “in Christ shall all be made alive,” is actually a figurative, vague idea that does not really mean what it says?
Latter-day Saints are fortunate to have 3 scriptural accounts of the Creation: Genesis 1-2, Moses 2-3, and Abraham 4-5. In substance they are all very similar and consistent. A case can be made, among Latter-day Saints, for questionable accuracy of particular or occasional Biblical passages, but not so with the supporting Mosaic and Abrahamic accounts of Creation. The Books of Moses and Abraham are particularly accurate since they were received directly by revelation, or by inspired translation to the Prophet Joseph Smith; no serious claim of mistranslation can be made for them. Therefore, LDS evolutionists are forced to consider the Creation accounts as figurative stories, rather than a problem of mistranslation.
But the consequences of this compromise extend farther than LDS evolutionists intended, and these consequences are dire and unavoidable. To illustrate, let this paper assume for just a moment that the LDS evolutionists are correct, and the Creation story is an inaccurate fable: Soon we realize that the Creation narratives give no clear indication of when fable becomes fact. Where does one draw the line? The LDS evolutionist must arbitrarily decide! Does a person start believing the scriptures at or around Genesis chapter 3? How can they be sure? Chapter 11, maybe? How can a person tell when the fables give way to true history? This is a slippery slope that can lead a person to deny every seemingly far-fetched aspect of the scriptures that does not square with modern theories. If this course is continued, eventually the Gospel itself is turned into a fable. And so it is that among evolutionists within the Church there are varying degrees of belief in the scriptures and very little agreement on fundamental concepts relating to the veracity of the word of God. There are those who have almost completely thrown the scriptures to the wayside, choosing to subordinate them completely to Darwinism, and those who still wish to preserve some semblance of the Gospel as presented in the scriptures, despite the pull from their evolutionary leanings.
But the scriptures should be trusted, and must be trusted. If a reader cannot trust the Creation story as Moses wrote it, then they cannot trust the Lord Jesus Christ, as he referenced Genesis several times in the New Testament.[24] He also said, “For had ye believed Moses, ye would have believed me: for he wrote of me. But if ye believe not his writings, how shall ye believe in my words?”[25] In fact, long ago, Christ was the one who revealed the Creation account to Moses in the first place.
Evolutionists in the Church generally accept that God used the method of evolution as taught in the textbooks, via naturalism. They also generally accept that the scriptural account of the Creation of the earth is not accurate to what really happened. But the scriptures make it clear that God is “a God of truth, and canst not lie.”[26] So then why, when he was personally giving Moses an account of the Creation of the earth,[27] did he give information in the wrong order? In virtually every instance, the scriptures differ in their chronology of the Creation from the evolutionary claims. Even if Christ was giving Moses a rather simplistic version of the Creation, why give him the information incorrectly? The chart below displays a few of the many inconsistencies between the two philosophies:[28]
Evolution Theory Creation
|
No grass in the time of dinosaurs. |
Grass came before beasts were on the earth (Moses |
|
Insects came before birds. |
Birds were created on day 5 (Moses |
|
Dinosaurs evolved into birds. |
Birds appear on day 5, before any land animals (Moses |
|
The earth began as a molten mass. Oceans came later. |
The earth started out covered in water (Moses 2:2). Dry land appeared afterward (Moses 2:9-10). |
|
The first animals were simple single-celled organisms. |
The first animals were great whales/sea creatures and birds – complex organisms (Moses |
|
The Sun lighted the earth long before plant life arrived. |
Plant life was formed on day 3, before the Sun was given as a light source on day 4 (Moses |
|
All life is related to each other and sprang from a common ancestor. |
Life brings forth only within distinct kinds (Moses 2:12, 21, 24; 1 Cor. 15:39). |
If mankind really did descend from lower animals, then all God would have had to do is tell that to Moses. There is nothing so complicated in that concept that the ancients would not have been able to understand it in simple terms. The Lord could have simply said that mankind was descended from the animals over a long period of time. Of course, the reason God did not tell this to Moses is because that is not how it happened.
It is very significant and cannot be over-emphasized that Joseph Smith, the great head of our dispensation, was not scripturally liberal. He believed what was written therein. A person can comb the teachings of Joseph Smith very carefully, and they will never find him to display the sort of attitude toward the scritpures displayed by modern LDS evolutionists. Did Joseph Smith consider the scriptures to be a mass of inaccurate fables? Despite the fact that he did initiate many corrections to the scriptures, it cannot be denied that he was a stalwart believer in their veracity.
There are other scriptural inconsistencies an LDS evolutionist is forced to accept. Evolution puts its subscriber into the awkward position of believing in uniformitarianism,[29] or the idea that all conditions on the earth have always been the same as they are today, and that what we see in the world is merely the product of long, continuous processes.[30] But this is not what is found in the scriptures. In the scriptures is recorded a story about a massive catastrophic event, namely the Flood.
To believe the scriptures and be consistent, a person must discard the notion of uniformitarianism and embrace catastrophism, which is to accept catastrophic events (like a great Flood) as the explanation for what we see in the world. To accept uniformitarianism is to deny a world-wide Flood, since such a Flood would surely have wiped out the evidence for slow and steady sedimentary deposits which are the foundation of uniformitarian theory. When it comes to the Flood and uniformitarianism, a person must reject one in favor of the other; they cannot have both.
In the scriptures it should be noted that the conditions of the pre-Flood earth were sufficient to allow people to live over 900 years old! Also, a race of giants existed,[31] which, after the Flood, existed only in ever-decreasing numbers.[32] Also, immediately after the Flood, the average ages dropped off dramatically.[33] Animals grew to a greater size in antediluvian times than they do today. Truly, conditions were not always as they are today, so uniformitarianism does not fit.
It cannot be denied that there was something different about the world prior to the time of the Flood than it is in our time. What that difference was exactly is impossible to determine now, although speculation on the matter would be interesting. But it is noteworthy to take a look at not only the tremendous size of pre-Flood fossils, but also lifespan. As it has been mentioned, it was not uncommon for a man to live past 900 years of age prior to the Flood. The average age of the Patriarchs born before the Flood (Adam to Shem) was about 882 years old (excluding Enoch who was translated at age 430[34]). From the Flood to Abraham (which is a time span of roughly 350 years), the average age dropped 597 years, to an average of 285 years old! That represents about a 68% decrease in lifespan over a mere 350 year period! Today average lifespan is about 1/10 of what it was before the Flood. What happened? As illustrated in the graph, there is an obvious connection between this rapid age decline and the Flood.[35] The conditions of the earth had changed after the Flood, making people live shorter lives. The witness of the scriptures that this is so is in direct contradiction to the theory of uniformitarianism.
[1] Webster’s New World Dictionary of the American Language, 2nd College Edition (New York: Simon & Schuster, 1986), 1275.
[2] Andrew Bailey, First Philosophy, Vol. II (Peterborough: Broadview press, Ltd., 2004), 217. Karl Popper concluded, “One can sum up all this by saying that the criterion of the scientific status of a theory is its falsifiability, or refutability, or testability.” (Popper’s emphasis)
[3] As quoted in Duane T. Gish, Creation Scientists Answer Their Critics (El Cajon: Institute for Creation Research, 1993), 35. Popper’s emphasis. Gish explains that Popper later modified this statement somewhat but never retracted it.
[4] As quoted in Duane T. Gish, Creation Scientists Answer Their Critics (El Cajon: Institute for Creation Research, 1993), 36.
[5] Klaus Dose, Interdisciplinary Science Reviews 13(4):348 (1988) as quoted in Duane T. Gish, Creation Scientists Answer Their Critics (El Cajon: Institute for Creation Research, 1993), 374.
[6] Sir Fred Hoyle, New Scientist,
[7] Neil A. Campbell and Jane B. Reece, Biology, 7th ed., (San Francisco: Pearson Benjamin Cummings, 2005), 77.
[8] H.P. Yockey, Journal of Theoretical Biology 67:377 (1977) as quoted in Duane T. Gish, Creation Scientists Answer Their Critics (El Cajon: Institute for Creation Research, 1993), 374.
[24] See Matthew 19:4 (Mark 10:6), Matthew 19:5-6 (Mark 10:7-9), Matthew 23:35, Matthew 24:37-39, Mark
[27] Moses 2:1 indicates that it is direct revelation from Christ to Moses, in the form of a personal interview or lecture.
[28] A similar, much more comprehensive chart is found in Walt Brown, In the Beginning, 7th ed., (Phoenix: Center for Scientific Creation, 2001), 276-280. However, it is assembled from the Protestant view and not every point is relevant to Mormonism.
[29] Neil A. Campbell and Jane B. Reece, Biology, 7th ed., (San Francisco: Pearson Benjamin Cummings, 2005), 440. In this text, we are given to understand that uniformitarianism is a precursor and a prerequisite to evolution theory. It reads, “Darwin agreed that if geologic change results from slow, continuous actions rather than sudden events, then Earth must be much older than the 6,000 years that theologians estimated. He later reasoned that perhaps similarly slow and subtle processes could act on living organisms over a long period of time, producing substantial change.”
[30] Ibid., 440. We are told that uniformitarianism proposes “that the same geologic processes are operating today as in the past, and at the same rate.”
[33] See Genesis 47:9 where it reads:
And Jacob said unto Pharaoh, The days of the years of my pilgrimage are an hundred and thirty years: few and evil have the days of the years of my life been, and have not attained unto the days of the years of the life of my fathers in the days of their pilgrimage.

Peter gave warning anciently against such a teaching as uniformitarianism, which undermines belief in the scriptures and ultimately in Christ himself. Peter predicted that there would be those in the last days who, in an attempt to discredit the Second Coming of Christ, would deny the plain truth of the Flood, replacing it with a false uniformitarian theory. He said:
Knowing this first, that there shall come in the last days scoffers, walking after their own lusts,
And saying, Where is the promise of his coming? for since the fathers fell asleep, all things continue as they were from the beginning of the creation.
For this they willingly are ignorant of, that by the word of God the heavens were of old, and the earth standing out of the water and in the water:
Whereby the world that then was, being overflowed with water, perished[1]
Evolution also has difficult implications for the concept of resurrection, since it is a natural consequence of the theory that there would be animals with useless parts that are remnants of evolutionary change. Do these animals retain their completely useless parts for all eternity? In “heaven, the paradise of God,” what we find is “that which is spiritual being in the likeness of that which is temporal; and that which is temporal being in the likeness of that which is spiritual; the spirit of man in the likeness of his person, as also the spirit of the beast, and every other creature which God has created.”[2] If an animal had only a partially developed wing, for instance, being neither one kind of animal nor the other, they would be doomed to remain like that in the resurrection. It would not be the case of correcting a physical deformity in the afterlife, for there would be no particularly correct form to which the animal should have belonged.
Compromising Adam
Among Latter-day Saints, there have been numerous variations of gospel/evolution compromise theories. These have been concocted, not because it is the plain teaching of scripture, but because of a desperate attempt to reconcile what is thought to be science with the gospel teaching. These compromises always fail scripturally. What is more, this article shall establish later that any such compromise is scientifically unnecessary.
Always these theories allow for death before the Fall of Adam. This issue has already been dealt with above (see heading “No Death before the Fall of Man”). The reader is asked to examine carefully the scriptures there listed to determine their plain and clear meaning
Always these compromise theories call into question the veracity of the Creation accounts of the scriptures (this issue was also dealt with above, see heading “Evolution Forces Us to Doubt the Scriptures”), and often cast doubt on the existence of Adam, or at least his character as a capable human.
It is significant that Joseph Smith made frequent reference to Adam in his teachings, and taught that he was intelligent, mighty, etc. “That [Adam] received revelations, commandments and ordinances at the beginning is beyond the power of controversy,”[3] the Prophet taught. And this so-called barely human, apish man stands next to Christ himself in authority as the next “Great High Priest” to whom all subsequent prophets must give an account of their stewardship.[4] There can be no doubt that the Prophet understood the events in the Creation narrative, with Adam, Eve, and a Garden, quite literally, since he went as far as to identify the precise location of the Garden of Eden in Jackson County, Missouri.[5] Was Joseph Smith wrong?
Joseph Smith knew well what he was talking about when he spoke of Adam, for he had even seen him in vision.[6] As to the knowledge and understanding received from heavenly visions, Joseph assured us that “Could you gaze into heaven five minutes, you would know more than you would by reading all that ever was written on the subject.”[7]
Joseph was a treasure trove of heavenly knowledge and insight. He knew the truth. In fact, Joseph Smith assured us, “I could go back and trace every subject of interest concerning the relationship of God to man, if I had time. I can enter into the mysteries; I can enter largely into the eternal worlds.”[8]
Would Joseph Smith have changed his opinions about Adam had he been contemporary with
Biological Sciences
It is scripturally unsound to believe in the evolution of organisms. As already discussed, the word of the Lord declares “Let the earth bring forth grass, the herb yielding seed, the fruit tree yielding fruit, whose seed should be in itself, after his kind…Let the earth bring forth the living creature after his kind, cattle, and creeping things, and beasts of the earth after their kind.”[12] In contrast to this, the theory of evolution states that all living things in the world are related to each other through a single common ancestor, which has since evolved into every living thing in the world today. The scriptural declarations about things consistently bring forth after their kind, coupled with the accompanying statement by the Prophet Joseph Smith which affirms this (see the above heading, “What is a ‘Kind’?”), utterly destroys the possibility of evolution theologically.
But what of the case for evolution on scientific grounds? Is there any merit to the evidence used to support evolution? Does the evidence used for evolution really pose a threat to the scriptural account of the Creation? The following will include an examination of the scientific considerations and biological evidences used to support evolution. It will be shown that those who believe the scriptures have nothing to fear of science, since it is favorable toward Creation.
Mutations
Genetic mutation is accepted as the only possible mechanism for evolutionary progress.[13] Students are told by evolutionists that mutations are the cause of change that leads to superior animals. These superiors then survive and propagate through natural selection, eventually becoming dominant over their primitive forebears. Is this picture accurate, or is it merely presenting a fairy tale scenerio, borne out of wishful thinking? The problem with this scenerio is that mutations are not as helpful to lifeforms as evolutionists would have us believe.
[3] Teachings of the Prophet Joseph Smith, selected and arranged by Joseph Fielding Smith (Salt Lake City: Deseret Book Company, 1976), 168.
[5] Larry E. Dahl and Donald Q.Cannon, Encyclopedia of Joseph Smith's Teachings (Salt Lake City: Bookcraft, 1997), 277.
[6] Teachings of the Prophet Joseph Smith, selected and arranged by Joseph Fielding Smith (Salt Lake City: Deseret Book Company, 1976), 158.
[11] Larry E. Dahl and Donald Q.Cannon, Encyclopedia of Joseph Smith's Teachings (Salt Lake City: Bookcraft, 1997), 238. Emphasis added.
[13] In Walt Brown, In the Beginning, 7th ed., (Phoenix: Center for Scientific Creation, 2001), 44, Theodosius Dobzhansky, “On Methods of Evolutionary Biology and Anthropology,” American Scientist, Dec. 1957, p. 385 is quoted as “The process of mutation is the only known source of the raw materials of genetic variability, and hence of evolution.”

How mutations work on the chromosome level. As should be noted, no new genetic information is created or added by this process. It is only a jumbling of existing information.
How helpful are mutations? Good question. These admissions from the scientific periodical American Scientist tell us that real-life mutations are not the great help that evolutionists would have you think they can be:
Accordingly, mutations are more than just sudden changes in heredity; they also affect viability, and, to the best of our knowledge, invariably affect it adversely.[1]
Mutation does produce hereditary changes, but the mass of evidence shows that all, or almost all, known mutations are unmistakably pathological and the few remaining ones are highly suspect.[2]
In order for mutations to be effective for evolution, they must produce superior, vibrant, and viable changes in creatures. This statement from N. Heribert Nilsson in the foreign scientific periodical Synthetische Artbildung displays the hopelessness of trying to reconcile this theoretical ideal to reality:
There is no single instance where it can be maintained that any of the mutants studied has a higher vitality than the mother species.[3]
Summing up what the men above have said on the matter, we have this statement from Dr. Walt Brown, the author of the comprehensive work, In the Beginning:
Mutations are the only known means by which new genetic material becomes available for evolution. Rarely, if ever, is a mutation beneficial to an organism in its natural environment. Almost all observable mutations are harmful; some are meaningless; many are lethal. No known mutation has ever produced a form of life having greater complexity and viability than its ancestors.[4]
No new genetic information is created or added during the mutation process; all that mutations do is scramble genetic information that already exists.[5] In fact, a mutation represents a loss of genetic information, not a gain.[6] And there are limits to genetic change; these are called “limits of variability.”[7] “Modern geneticists recognize that within any particular animal or plant species, there are known limits in the size, limits in the varieties of color, and limits in the shape, as well as limits in other characteristics.”[8] Genetic mutations are like mixing around letters of the alphabet. For instance, visualize a written word as a composite of its several letters. The letters in the word can be shuffled and switched around, but if the letters are not already available, then there is nothing to switch. A person will never be able to spell the word “MUSTARD” by mixing around the letters in “CRANBERRY”; but they would be able to spell words like “crab,” “yarn,” “can,” “berry,” etc.
This poses a great problem for evolution, since, in order for the theory to work, new genetic information has to be created by mutations all the time. But this is not what we observe happening in the world: new genetic information is never created. An evolutionist must believe that mutations can do things that they have never been observed to do! This sounds like a fairy tale, not a conclusion drawn from rational evidence.
Carl Werner, author of Evolution: The Grand Experiment, in which evolution is evaluated objectively by considering what both its proponents and detractors say, comments:
The section of DNA (gene) that determines a fruit fly’s normal red eye color is thousands of letters long and looks something like this: ACCGATTTTCACCGCGAATGCAAGCG, etc. Now, if one of the DNA letters is accidentally changed in this section of DNA (in the eye pigment gene), then the normal eye pigment may be white instead of red and will not function properly.
[I]n humans, genetic diseases, such as sickle-cell anemia, cystic fribrosis, spina bifida, and hemophilia, are also the result of one simple, accidental letter change in a particular section of DNA. In these diseases, one letter of DNA – out of billions of letters of DNA needed to form a human being – is incorrect…[C]ould new complicated and integrated systems, such as a fish’s gills (and associated structures), or a bird’s wing (feathers, bones, and muscles), or a cardiovascular system (heart with blood vessels and lungs), come about through the accumulation of a series of accidental mutations? To form a complicated new body system would require adding or changing thousands of letters of DNA in the egg or sperm of the parent organism, not just one letter. Moreover, these thousands of letters of DNA would not only have to be accidentally placed in the correct location, but also in the correct sequence.[9]
In light of this the author now asks, how is believing in evolution more reasonable than attributing life to special Creation? In response to those who would disagree, the author says simply: you have got to be kidding.
The common understanding is that animals “adapt” to their surrounding environment by means of the genetic mutations. But this displays an innaccurate way to think of mutations. If someone explains to you that this is how evolution works, they are mistaken and are subscribing to an archaic myth surrounding evolution. Mutations are completely random and do not respond to environmental circumstances like that.[10] For an animal to sprout gills because its genes are adapting to being around the water a lot is “genetically impossible.”[11] That is not how genes work. They would not respond by mutating. If a mutation occurred, it would be by complete blind chance, not response. This makes evolution even less likely, because now not only do beneficial mutations have to accidentally occur, but the accidental mutations must be appropriate to the specific circumstances of the evolving organism!
Unfortunately for evolution, mutations are relatively rare,[12] usually harmful, and are only ever a scrambling of genetic information that was already there. Furthermore, the mutants are almost exclusively observed to be inferior to the original design, not superior.[13] In other words, mutations do precisely opposite of what evolutionists want them to do. The burden of proof is on the evolutionists. In order to have any convincing power they need to explain this very pressing question: Where did all this genetic material come from in the first place? And then they need to provide us with an answer that satisfies the observed, objective evidence. But they cannot give us such an explanation, outside of special Creation.
Mutations of microorganisms like bacteria are often cited as some of the best evidence for evolution. However, mutating bacteria never mutates into something that is not bacteria. The law of organisms bringing forth “after their kind”[14] is not broken. This is merely a case of microevolution, which is variation within a kind of organism. Speaking about acquired bacterial resistance to antibiotics, Dr. Daniel Criswell says,
Although it appears these mutations are beneficial and provide an advantage to the bacterium possessing them, they all come with a cost…The mutation may confer a benefit in a particular environment, but the overall fitness of the population of one kind of bacterium is decreased as a result of a reduced function of one of the components in its biological pathway. The accumulation of mutations doesn't lead to a new kind of bacterium—it leads to extinction.[15]
And so it is with all forms of life regarding mutation. The original design is the most versatile, and therefore the one with the most general advantage.
[1] C. P. Martin, “A Non-Geneticist Looks at Evolution,” American Scientist, January 1953, p. 102 as quoted in Walt Brown, In the Beginning, 7th ed., (Phoenix: Center for Scientific Creation, 2001), 44.
[3] N. Heribert Nilsson, Synthetische Artbildung (Lund, Sweden: Verlag CWK Gleerup, 1953), p. 1157 as quoted in Walt Brown, In the Beginning, 7th ed., (Phoenix: Center for Scientific Creation, 2001), 44.
[4] Walt Brown, In the Beginning, 7th ed., (
[5] Gary Parker, Creation, Mutation, and Variation, retrieved from http://www.icr.org/article/171/ on
[6] Retrieved from http://creationontheweb.com/content/view/3268/ on
[13] See Walt Brown, In the Beginning, 7th ed., (
[15] Daniel Criswell, The "Evolution" of Antibiotic Resistance, retrieved from http://www.icr.org/article/14/ on
Similar Structures
One of the most blatant uses of inadequate evidence evolutionists employ to perpetuate their theory is the similarity of structures among organisms. Evolutionists tout that many living creatures resemble each other in their structures, and say that this is evidence for a common ancestor. The failure of this argument is that the very same evidence can just as readily be interpreted as evidence for a common Designer! Maybe evolutionists should consider this idea: perhaps the same Person made everything! If that were the case, then that would easily explain something like a commonality in the created things, like similarity of structure among organisms. Once this idea is pondered on for a few moments, it becomes apparent that the evolutionists do not have a very compelling case here. This is especially true seeing as how homologous (similar) structures are found on organisms that were supposed to have evolved from different ancestors.[1] What a weak piece of evidence. Yet it always comes up when evidence for evolution is discussed!
Which side of the issue should be taken by readers, the common ancestor argument or the common Designer? Nowhere do the scriptures teach that all life ultimately descended from a common ancestor, but they certainly do teach the reality of a common Designer:
“there is a God, and he hath created all things, both the heavens and the earth, and all things that in them are”[2]
The Lord patterned the design of many animals and creeping things after a manner similar to the structure of man. Perhaps this is because it was a good design in the first place. The old cliché comes to mind: “If it ain’t broke, don’t fix it.”
It makes no difference whether the structures in question are muscles, bones, cells, or DNA codes; this Common Designer argument for similar structures always holds.
There is also a very practical reason for all living creatures to share similar proteins, etc. That allows for your body to synthesize materials it needs from eating other living things, like beef, chicken, or vegetables. If other life forms were made of different, incompatible materials, eating would avail us nothing.[3] And so there are good reasons, from a Design standpoint, for similar designs.
[3] Sylvia S. Mader, Inquiry into Life, 10th ed., (
Homologous (similar) structures. The presence of similar structures is just as easily interpreted for the Design argument.

Vestigial Structures
Chances are that the readers of this paper, like the author, have been told in school that they have a vestigial (i.e. no longer functional) appendix attached to their colon, or that their coccyx (tailbone) is the remnant of a monkey-like tail and is now no longer necessary. This is false information that is being passed off onto the public by evolutionists in order to promote their theory. The Lord, in a metaphor for the Church organization, has told us unequivocally that there are no vestigial structures:
[L]et not the head say unto the feet it hath no need of the feet; for without the feet how shall the body be able to stand? Also the body hath need of every member…that the system may be kept perfect.[1]
Likewise Joseph Smith taught that the Priesthood “may be illustrated by the figure of the human body, which has different members, which have different offices to perform; all are necessary in their place, and the body is not complete without all the members.”[2]
It is indeed a fact that the appendix has a function. For years students have been told that it is a useless left-over from our evolutionary past. This author has been told that in College classrooms as recent as 2006. But the appendix is not useless, and has a role in combating disease in the body:
The Grolier Encyclopedia admitted, “Long regarded as a vestigial organ with no function in the human body, the appendix is now thought to be one of the sites where immune responses are initiated.” Authors Van De Graff and Fox state, “The appendix contains masses of lymphoid tissue that may serve to resist infection.” Kenneth Saladin states, “The appendix is densely populated with lymphocytes [a type of white blood cell] and is a significant source of immune cells.”[3]
As to the coccyx bone, “The coccyx is a vital anchor for certain muscles needed for our upright posture—an excellent design feature.”[4] It is not useless either! Evolutionists in the past were quite over-zealous in declaring all sorts of body structures as vestigial. If a structure’s function was unknown, then it was automatically assumed to be useless. But as science progresses, mankind is learning that structures once thought to be superfluous have a perfectly good reason for being.
Even small amount of function proves a function, and therefore debunks the outdated vestigial structures argument. But most of the time these days, evolutionists will slink around this by claiming that the “vestigial” structures’ functions are reduced, implying that they used to have more function once upon a time. This argument has no real convincing power, because 1) the structures are presently useful, and 2) there is no way to prove that the structures used to have more function than they do today. Neither is it compelling to suggest that structures may have operated differently long ago and far away. All speculation on this matter is virtually akin to science fiction.
As science has advanced throughout the years, uses for once-mysterious organs have come to light. Unfortunately, the misinformation about vestigial structures dies hard. Evolutionists are very quiet about the fact that uses for structures once thought to be vestigial have been found, and misinformation about “vestigial structures” is still being offered to students as evidence for evolution. And so many well-meaning people do not know they have been misinformed.
[2] Teachings of the Prophet Joseph Smith, selected and arranged by Joseph Fielding Smith (Salt Lake City: Deseret Book Company, 1976), 112, emphasis added.
[3] Frank Sherwin, For Every Structure There is a Reason…, retrieved from http://www.icr.org/article/220/ on
[4] Tas Walker, Creationists Attacked in
The So-Called Mitochondrial Eve
Evolutionists have heralded new evidence for evolution in the form of genetics. In the body cell there is an organelle called the mitochondrion. Its function is to supply energy for the body, but it also contains a small amount of DNA. This mitochondrial DNA (or mtDNA) is inherited from the mother only. By evaluating the mitochondrial DNA, scientists have been able to determine that all human beings share the same woman ancestor. This mother of mankind has been dubbed “Mitochondrial Eve.”
The crucial question is: how long ago did this Mitochondrial Eve live? Based on evolutionary assumptions, the first approximation was somewhere around 100,000-200,000 years ago. However, it has since been found that because of a much higher-than-thought rate of mtDNA mutations, that original date is nowhere close to accurate. With the new and more accurate estimation it was determined that this common female ancestor lived a mere 6000 years ago![1]

Age of the Earth and the Flood
In order for evolution to happen, it is absolutely imperative that the Earth be extremely old. This is the crucial lynchpin of the theory. If all those millions of years are taken away, then suddenly evolution appears very ridiculous. After all, with evolution, millions of years is the magic ingredient that makes the impossible possible.
How old is the Earth? The Book of Abraham gives us the key to this mystery. In every instance where the Mosaic account uses the word “day” to denote a creation period, Abraham uses “time.”[1] Furthermore, we are told what the duration of a “time” is:
And the Lord said unto me, by the Urim and Thummim, that Kolob was after the manner of the Lord, according to its times and seasons in the revolutions thereof; that one revolution was a day unto the Lord, after his manner of reckoning, it being one thousand years according to the time appointed unto that whereon thou standest. This is the reckoning of the Lord's time, according to the reckoning of Kolob.[2]
Furthermore, regarding the forbidden fruit, the Lord told Adam in the Abrahamic account, “in the time [1000 years] that thou eatest thereof, thou shalt surely die.”[3] Note that in the other Creation accounts here also “time” is interchanged with “day.” Adam certainly did die within the time that he ate the fruit, for “all the days that Adam lived were nine hundred and thirty years: and he died.”[4] Joseph Smith also apparently taught this concept in these words:
Now, as to Adam, the Lord said, ‘In the day thou shalt eat thereof thou shalt surely die.’ Now, the day the Lord has reference to is spoken of by Peter: a thousand of our years is with the Lord as one day, etc. At the time the Lord said this to Adam there was no mode of counting time by man as man now counts time.[5]
This being known, 7 creative periods of 1000-year duration, plus the approximate 6000 years of human history, yield (7000 + 6000) approximately 13,000 years as the age of the Earth since the Creation commenced. There are some that would take license from this and surmise that this creative time can account for all those geologic periods the evolutionists make so much of. However, before Adam partook of the fruit, there was no decay, death, or geologic turmoil, since “all things which were created must have remained in the same state in which they were after they were created”.[6] Therefore we cannot attribute the geologic eras taught as part of evolution theory to the 7 creative periods. The world we see today, with its fossils, geologic strata, and radioactive decay is a product of the 6000 years of human history.
Also, this is confirmed to be the case because the Earth is allotted “seven thousand years of its continuance, or its temporal existence.”[7] That is, 6000 years of human history + the Millennium (1000 years) = approximately 7000 years. Therefore, geological turmoil, radioactive decay, death of organisms and their subsequent transformation into fossils, must have occurred after the earth was in its initial stable, uncorrupt paradise state, after it had been transformed by the Fall of Adam and commenced its temporal existence of death, decay, and turmoil.
How do we account for the strata of the earth and other features in only a period of 6000 years? We must consider what great events happened in the history of the earth to make it so. The Flood of Noah (approximately 2344 B.C.)[8] was the most catastrophic event this world has ever seen. The entire previous world was destroyed.[9] It is because of this great Flood that we see the many geological phenomena often interpreted as being very old. In actuality, it all happened quite quickly with a single, catastrophic event. The Flood accounts for most of the world’s fossils, the geologic strata found around the world, and other deformed topography of the earth.
[5] Larry E. Dahl and Donald Q.Cannon, Encyclopedia of Joseph Smith's Teachings (Salt Lake City: Bookcraft, 1997), 21.

A depiction of the rising waters of the Flood of Noah. There can be no doubt that the Flood was the most catastrophic event the world has ever seen; to it we may attribute the vast fossil graveyards, geologic strata, and the deformed topography of the earth.
The Contents of the
How many animals were on Noah’s
What animals were on the Ark? Noah needed only to bring creatures “wherein is the breath of life,” or in other words, “in whose nostrils was the breath of life.”[1] It goes without saying that it would not be necessary to bring aquatic life, since there was plenty of water outside the
Certainly Noah brought representatives from each of the basic kinds of animals, but not every particular variety. For instance, the ark would have contained primal representatives of the dog kind, and afterwards, over time, dogs have diversified into all the present varieties we see today. This would be the case with all of the animals placed on the
The Geologic Column
The Geologic Column is a theoretical model used to determine geologic time, and is said to be composed of layers of rock formed from distinctive periods of the Earth’s history. The Geologic Column consists of three major subdivisions, called “eras,” which are Paleozoic (“old life”), Mesozoic (“middle life”), and Cenozoic (“new life”); these eras are divided into twelve “periods,” beginning with the Cambrian, next is the Ordovician, the Silurian, the Devonian, Mississippian, Pennsylvanian, Permian, Triassic, Jurassic, Cretaceous, Tertiary, and finally the Quaternary period in which we are supposed to be living.[1] The geologic “periods” are further divided into “epochs.”[2] Each “period,” or layer, is supposed to represent a different age of millions of years.[3]
It is astonishing how universally the Geologic Column is assumed to be true. Even those within The Church of Jesus Christ of Latter-day Saints feel they must accommodate for this proposed column in their religious thought. Sadly, those who have thought so have been misled, and have subjected themselves to serving this master, which is hardly more real than Santa Claus. The Geologic Column, as it is presented to the students, does not exist in the real world:
Only a few locations on earth (about 0.4% of its area) have been described with the succession of [the geologic column layers]…. Even where the [layers] may be present, geologists recognize individual [layers] to be incomplete. The entire geologic column, composed of complete strata systems, exists only in the diagrams drawn by geologists![6]
As Dr. Walt Brown explains:
Practically nowhere on Earth can one find the so-called “geologic column.” Most “geologic periods” are missing at most continental locations. Only 15–20% of Earth’s land surface has even one-third of these periods in the correct order. Even within the
In many cases the layers of the Geologic Column are not neatly in order, as a person would expect who has been indoctrinated by the Geologic Column representations in text books. Such an idea as the textbooks represent is misleading; the truth is along these lines:
Hundreds of locations are known where the order of the [layers] identified by geologists does not match the order of the geologic column. Strata systems are believed in some places to be inverted, repeated, or inserted where they do not belong.[8]
One of the most startling finds that throws a wrench into the evolutionary interpretation of the rock layers is the presence of polystrate fossils. Polystrate fossils are fossils, usually mineralized trees, which run continuously through multiple rock layers. They are found all over the world, and refute the idea that each layer represents a different age.[9]
Obviously the trees were deposited quickly along with the rest of the sediments; they could not have grown up through the layers. It is silly to think that a tree would stand up straight for millions upon millions of years as sediment slowly forms around it. What is more, often these trees are found upside down.[10] This is an even bigger problem, since trees obviously do not grow upside down. So how did they end up in that position, surrounded by layers and layers of sediment? The only logical answer is that they were deposited there rapidly, along with quick burial by successive layers.
Many people are intimidated by evolutionists’ confident declarations of the age of fossils. The evolutionists seem so certain that hardly anyone dares to question their interpretation. However, the system used to date the fossils found in the rock layers of the “Geologic Column” employs circular reasoning! Fossils found in distinct layers are dubbed “index fossils” because they are supposed to indicate how old the rock layer is. Strangely, the method used to find how old the fossils themselves are is by what layer of rock they appear in! They date the fossils by the rock layers and the rock layers by the fossils! The problem is here explained:
It cannot be denied that from a strictly philosophical standpoint geologists are here arguing in a circle. The succession of organisms has been determined by a study of their remains embedded in the rocks, and the relative ages of the rocks are determined by the remains of organisms that they contain.[11]
A method like this is useless in finding the true dates. The next time someone declares how old an ancient fossil is, the first questions that should be asked are, “How do they really know that? Were they there? Can they prove it? Are they old enough to have seen the thing die and slowly form into a fossil? Or do they have video footage of the event or something that can verify it? Or is this just their speculation, their belief?”
There is simply no reason to be impressed with or intimidated by the geologic “evidence” for evolution. Unfortunately, it seems that many accept evolutionary interpretations and speculations about the earth’s geology out-of-hand, as if on faith. Except that faith is a belief in something that is actually true.[12] Unlike faith, belief in something false is not productive for anything.
[1] Charles C. Plummer and David McGeary, Physical Geology (Dubuque, Iowa: Wm. C. Brown Company, 1979), 145.
[4] Terry Mortenson, The origin of old-earth geology and its ramifications for life in the 21st century, retrieved from http://www.creationontheweb.com/content/view/1579/ on
[5] Neil A.
[6] Steven A. Austin, Ten Misconceptions about the Geologic Column, retrieved from http://www.icr.org/article/242/ on
[8] Steven A. Austin, Ten Misconceptions about the Geologic Column, retrieved from http://www.icr.org/article/242/ on

The Answer: Liquefaction
Why is much of the earth layered? If it was not the slow deposits of time, what was it that caused the strata and other phenomenon around the world? The layered effect of sedimentary rock common throughout the world was caused by the Flood of Noah, in which mud and organismal remains were deposited rapidly. Dr. Walt Brown explains:
In the early 1800s, some observers in
The hydrodynamic principle is called liquefaction. It is readily observable and adequately explains the layer phenomena we see in the world. Dr. Brown goes on to explain:
During liquefaction, denser particles sink and lighter particles (and dead organisms soon to become fossils) float up – until a liquefaction lens is encountered. Lenses of water form along nearly horizontal paths if the sediments below the path are more porous than those above, so more water flows up toward that path than away from that path. Sedimentary particles and dead organisms buried in the sediments were sorted and resorted into vast, thin layers.[2]
In an unpublished experiment at
Liquefaction sorts particles by making them buoyant.

Cave Formation
Evolutionists claim that the existence of limestone caves is another surefire evidence of the earth being extremely old. In actuality, it does not take millions of years for cave stalagmites and stalactites to grow, if conditions are favorable. The Lincoln Memorial in
A 1953 National Geographic article showcased a stalagmite on which a dead bat had fallen. This bat became nearly covered in limestone before it even had a chance to decay.[2]
[1] Stephen Meyers & Robert Doolan, Rapid stalactites, retrieved from http://www.creationontheweb.com/content/view/1142/ on

Fossil Formation
Fossils are “the remains or traces of organisms preserved from the geologic past.”[1] This is often accomplished by the process of becoming petrified, in which the original substance was “replaced by mineral matter from circulating solutions or that open spaces have been filled by minerals.”[2]
How long does it take for a fossil to form? It is commonly perpetuated that fossils take millions of years to form, and that the mere presence of a fossil is proof of its antiquity. However, if the right conditions are present, it does not take very long.[3] The Flood provides an ideal situation for remains being mineralized en masse. A creationist opinion of the fossils, such as this one, offers an explanation:
Fossils have been frequently cited as the main evidence for evolution. The evolution/uniformitarian worldview postulates that the slow and gradual processes we see operating today are responsible not only for the death and extinction of plant and animal types but their burial in sediments which will eventually harden into sedimentary rocks. Uniformity’s slogan, “the present is the key to the past,” reflects their view of the origin of the features in the rock and fossil record. I think the great Flood of Noah’s day is a better explanation.
First note that very few fossils are forming today and then only in the case of rapid burial by water. For instance what happens to a fish when it dies? It either floats to the surface or sinks to the bottom where it decays and is eaten by scavengers. Yet many fish fossils are so exquisitely preserved that even the scales and organs are preserved. Obviously there was no time for decay and bacterial action. We can certainly say that something extraordinary happened to form the fossils.[4]
Just because a fossil is present, it does not mean that it is millions of years old. Fossils can form very quickly. Displayed in the picture is an example of a modern artifact which has undergone the same petrifying process as fossils.
[1] Frederick K. Lutgens and Edward J. Tarbuck, Essentials of Geology, 2d ed. (Columbus, Ohio: Charles E. Merrill Publishing, 1986), 289.
[3] John Morris, Are Fossils the Result of Noah’s Flood?, retrieved from http://www.icr.org/article/504/ on
[4] John Morris, Are Fossils the Result of Noah’s Flood?, retrieved from http://www.icr.org/article/504/ on

The
There happen to be small parallels, or geologically comparable sites, to the
Surely, if the formation of the “
Another interesting site is the
These examples show that canyons can form rapidly and suggest that a catastrophic event, like the Flood of Noah, is a valid explanation for the
[1] This intriguing scenario is described in Walt Brown, In the Beginning, , 7th ed., (
[2] Steven A. Austin, Mt. St. Helens and Catastrophism, retrieved from http://www.icr.org/index.php?module=articles&action=view&ID=261 on
[4] John Morris, A canyon in six days!, retrieved from http://www.creationontheweb.com/content/view/421 on

Diamonds
It is commonly thought that diamonds are a product of millions of years of pressure from geologic forces. It is true that diamonds are made from carbon in conditions of extreme heat and pressure, yet time is not necessarily a crucial element in this process, much less millions of years. By mimicking the forces of nature, real diamonds have been made in a laboratory setting in a time span as short as six months. These diamonds “are molecularly identical to naturally occurring diamonds. They possess exactly the same traits—hardness, brilliance, fire and luster.”[1] The company that creates these diamonds can forge them from the cremated remains of loved-ones as a sort of memorial.
[1] LifeGem website http://www.lifegem.com as quoted in http://creationontheweb.com/content/view/5704/. Information retrieved
The Helium Escape Problem
Another interesting evidence for a young Earth is the puzzling problem of amounts of helium in the atmosphere. Virtually no helium escapes into space, yet there is not enough helium in the atmosphere for a billions-of-years-old earth. So if the earth is 4.6 billion years old, why is there not more helium in the atmosphere? As Dr. Walt Brown explains:
Radioactive decay of only uranium and thorium would produce all the atmosphere’s helium in only 40,000 years. No known means exists by which large amounts of helium can escape from the atmosphere, even when considering helium’s low atomic weight. The atmosphere appears to be young.[1]
Human Artifacts in Solid Coal
It is thought by those who believe in an old Earth that the presence of coal is just another proof of millions of years. A typical evolutionary-influenced statement about the antiquity of coal is as follows:
The process [of coal formation] is extremely long…The most favourable period for the creation of coal was the Carboniferous Period (carboniferous means ‘coal-bearing’), between 360 and 290 million years ago. However, smaller quantities of coal continued to be formed in certain regions during all the subsequent epochs: the Permian Period (290 to 250 million years ago), and the Secondary Period (Mesozoic Era, 250 to 65 million years ago).[1]
According to evolutionary theory, humans have only arrived on the scene as recently as a few million years ago. Yet there is interesting, though anecdotal, evidence that human artifacts have been found embedded inside solid coal. How can this be? It is evident that coal was formed very quickly in the Flood of Noah.
At various times and places, man-made objects have been found encased in coal. Examples include a thimble, an iron pot, and iron instrument, an 8-karat gold chain, three throwing-spears, and a metallic vessel inlaid with silver. Other ‘out of place artifacts’ have been found inside deeply buried rocks: nails, a screw, a strange coin, a tiny ceramic doll, and other objects of obvious human manufacture. By evolutionary dating techniques, these objects would be hundreds of millions of years older than man.[2]

Continental Erosion
Uniformitarianism assumes that geologic processes have been occurring at a constant rate for billions of years. Based on erosion rates in the earth today, however, the mountains (and particularly the fossils contained in them) cannot be as old as evolutionists think. Walt Brown further explains the problems of the earth being billions of years old, and the fossils found in sedimentary rock being likewise old:
The continents are eroding at a rate that would level them in much less than 25 million years. However, evolutionists believe fossils of animals and plants at high elevations have somehow avoided this erosion for more than 300 million years. Something is wrong.[1]
Just imagine how high the mountains would have to have been in antiquity long before man for them to be as old as the evolutionists say they are! The erosion problem is one that is often not thought of, but is very relevant – especially when considering sedimentary rock with fossils said to as old as they are.
The Ocean Salt Problem
The oceans are continually getting saltier since millions of tons of sodium are deposited into the ocean from rivers and elsewhere. Only 27% of this salt leaves the ocean; the rest apparently just accumulates.[1] This is a vexing problem for evolutionists, since:
If the sea had no sodium to start with, it would have accumulated its present amount in less than 42 million years at today's input and output rates. This is much less than the evolutionary age of the ocean, three billion years. The usual reply to this discrepancy is that past sodium inputs must have been less and outputs greater. However, calculations that are as generous as possible to evolutionary scenarios still give a maximum age of only 62 million years.[2]
This raises a serious problem for uniformitarianism (processes always happening at the same rate as they do today), and old Earth theories in general. The data just does not fit the theory. If one believed in catastrophic explanations, however, then the presence of an accumulation of 42 million years-worth of sodium (by today’s rate) might have occurred in a very brief period of time. And one could easily maintain a belief in a young Earth. We cannot assume a continuous rate of change.
[1] D. Russell Humphreys, Evidence for a Young World. Retrieved from http://www.icr.org/article/1842/ on
[2] D. Russell Humphreys, Evidence for a Young World. Retrieved from http://www.icr.org/article/1842/ on
Carbon/Radiometric Dating
Many people assume that scientists have proven that the earth is billions of years old by Carbon or similar radiometric dating. The logical problem with this should be glaringly apparent: that is, we cannot go back in time and “check the answer.” The possible solutions to this problem are this: either we find a person who is old enough to have seen the beginning of the earth and ask them to verify its age, or we invent time travel and find out first hand. But since neither of these suggestions is possible, it comes back to belief again.
Furthermore, many of the people who accept the accuracy of Carbon dating out of hand are completely ignorant of the theory behind the process and the assumptions involved. It works like this: as sunlight strikes the atmosphere of the earth, it converts a tiny amount of Nitrogen into a radioactive isotope of Carbon, called Carbon 14, or C-14 (Carbon’s normal atomic weight is 12). Slowly, this radioactive isotope decays back to its Nitrogen form. By extrapolation, it is understood that it would take about 5730 years for half of the C-14 molecules to decay. This amount of time it takes for half of the substance to decay is called a half-life. In another 5730 years, only ¼ of the radioactivity would be left, and half of that would be gone in another 5730 years, and so on like that.
C-14 enters into plant life along with regular Carbon in the form of CO2. As animals eat the plants, they take on the radioactive C-14 in their systems in the same ratio. After the organisms die, they stop assimilating C-14. Scientists then measure the amount of C-14 in old material that was once living, compare it to the amount of C-14 in the atmosphere now, and count backward in half-lives to determine how old the sample is.
The problematic assumptions with this technique are:
§ The concept of uniformitarianism is assumed to be true. As we have already established, uniformitarianism is in complete opposition to the scriptures and the Flood (which represents catastrophism). In order for Carbon dating to work, the amount of Carbon 14 in the atmosphere must have always been the same. Even if this were true, it could not be verified scientifically.
§ Because C-14 is constantly being created in the atmosphere by sunlight, and it is also constantly decaying away, it must have at some point reached an equilibrium where the amount stabilizes. It was calculated that this would have taken place after 30,000 years.[1] Of course, it is assumed that the earth is much older than that, so the equilibrium problem can be overlooked. However, the amount of C-14 is still in fluctuation, showing that it has not reached equilibrium.[2] This indicates that the earth is less than 30,000 years old.
§ It is assumed that Carbon 14 has always decayed at the same rate. This is impossible to verify.
§ It is assumed that the sample is pure and uncontaminated.
Carbon dating can only be used for material that was once living. There are other radiometric dating methods, like Potassium-Argon dating, which can date non-organic materials. But all these methods are fundamentally flawed, since dating for samples of unknown age obviously cannot be subject to “checking the answer.” This creates a cloud of uncertainty. But what is more problematic is that many times when radiometric dating is done on things of known age, ridiculous dates are given:
“Living mullosk shells were dated up to 2300 years old.”[3] “Basalt from
Results like the ones above ought to put a major dent into the credibility of radiometric dating methods and those who swear by them. But as if these inconsistencies were not bad enough for the evolutionists, there are times when samples of unknown age are given dates that seriously conflict with evolutionary theory:
“Material from layers where dinosaurs are found carbon dated at 34,000 years old.”[8] “One part of Dima [a baby frozen mammoth] was 40,000, another part was 26,000 and the ‘wood immediately around the carcass’ was 9-10,000.”[9] “The lower leg of the Fairbanks Creek mammoth had a radiocarbon age of 15,380 RCY, while its skin and flesh were 21,300 RCY.”[10]
The practice of radiometric dating is actually highly subjective, contrary to what evolutionists would like you to believe. If the dates found do not appear to fit in with the accepted evolutionary timeline that has been arbitrarily concocted, they will be thrown out. The entire concept is dependent on the geologic column being true and correct (and we have already established that it is not). Don Batten, Ken Ham, Jonathan Sarfati and Carl Wieland, associates of Creation Ministries International (formerly known as Answers In Genesis), explain the subjective nature of radiometric dating in these words:
The forms issued by radioisotope laboratories for submission with samples to be dated commonly ask how old the sample is expected to be. Why? If the techniques were absolutely objective and reliable, such information would not be necessary. Presumably, the laboratories know that anomalous dates are common, so they need some check on whether they have obtained a ‘good’ date… When a ‘date’ differs from that expected, researchers readily invent excuses for rejecting the result. [11]
Often the predisposition to belief in radiometric dating is a great hindrance to reasonable thinking. An exemplary instance is seen in the case of the Laetoli Footprints of northern
[3] Science, vol. 141, 1963, p. 634-637 as quoted in Kent Hovind, Creation Science Evangelism Seminar Notebook. (
[4] Earth and Planetary Science Letters, 6-47 55 as quoted in Kent Hovind, Creation Science Evangelism Seminar Notebook. (
[5] Earth and Planetary Science Letters, 6-47 55 as quoted in Kent Hovind, Creation Science Evangelism Seminar Notebook. (
[6] Science, vol. 224, 1984, pp. 58-61 as quoted in Kent Hovind, Creation Science Evangelism Seminar Notebook. (
[7] Antarctic Journal, vol. 6, Sept-Oct. 1971, p. 211 as quoted in Kent Hovind, Creation Science Evangelism Seminar Notebook. (
[8] Earth’s Most Challenging Mysteries, 1972, p. 280 as quoted in Kent Hovind, Creation Science Evangelism Seminar Notebook. (
[9] Troy L. Pewe, Quaternary Stratigraphic Nomenclature in Unglaciated Central Alaska, Geological Survey Professional Paper 862 (U.S. Gov. printing office, 1975) p. 30 as quoted in Kent Hovind, Creation Science Evangelism Seminar Notebook. (
[10] Harold E. Anthony, “Nature’s Deep Freeze,” Natural History, Sept. 1949, p. 300 as quoted in Kent Hovind, Creation Science Evangelism Seminar Notebook. (
[11] Don Batten, Ken Ham, Jonathan Sarfati & Carl Wieland, What about carbon dating? Retrieved from http://www.creationontheweb.com/content/view/3663 on

Absence of Intermediate Forms in Fossils
Evolutionists are an indecisive bunch. Out of one side of their mouth they boast about how much fossil evidence they have found that confirms evolution. Yet, out of the other side, they are continually searching for all those “missing links.” If life evolved from more primitive forms, then logically there should be a vast number of intermediate forms found in fossils. Ever since
And by this theory innumerable transitional forms must have existed, why do we not find them embedded in countless numbers in the crust of the earth? The number of intermediate links between all living and extinct species must have been inconceivably great![1]
Today the store of fossils that has been accumulated is extensive and exhaustively researched. But the problem of lack of intermediates that existed in
In the years after
Actually, the desperate lack of transitional forms is what inspired Goldschmidt to propose the ridiculous evolutionary sub-theory of punctuated equilibrium,[4] which proposes that evolution occurred in quick jumps without progression. Goldschmidt said, “The first bird hatched from a reptilian egg.”[5] This cop-out silliness is used to side-step the problem of lack of intermediates in fossils. One can imagine the extreme genetic difficulties with such an idea (see the above heading, “Mutations”). Nevertheless, because of the lack of fossil evidence, punctuated equilibrium is taken seriously out of necessity by a branch of evolutionists the likes of Stephen Jay Gould (now dead), the Professor of Geology and Paleontology at Harvard University. Gould said this about the lack of fossil evidence:
The extreme rarity of transitional forms in the fossil record persists as the trade secret of paleontology. The evolutionary trees that adorn our textbooks have data only at the tips and nodes of their branches; the rest is inference, however reasonable, not the evidence of fossils.[6]
If fossil evidence for evolution was really so compelling, then whence even the existence of punctuated equilibrium theory, let alone it being seriously considered by the experts? The very existence of the punctuated equilibrium sub-theory is proof that the evolutionists are having great troubles trying to square their theory with the evidence in the earth. It shows that the evolutionists will not let a thing like lack of evidence destroy their belief in their theory, which in turn demonstrates that evolution is not based in science, but is a deeply cherished belief.
[1] Charles Darwin as quoted in Kent Hovind, Creation Science Evangelism Seminar Notebook. (
[2] Duane T. Gish, Creation Scientists Answer Their Critics (El Cajon: Institute for Creation Research, 1993), 223-224.
[3] David M. Raup, “Evolution and the Fossil Record,” Science, vol. 213 (
Archaeopteryx
A common image projected by evolutionists to propagate the myth of bounding fossil evidence is Archaeopteryx, the famous half-bird, half-reptilian-looking creature. There is actually convincing evidence that Archaeopteryx may be a fraud.[1] Before this suggestion is swiftly dismissed, it should be remembered that such a thing is not unheard of. The famous Piltdown Man was accepted among the experts for over 40 years before it was exposed as a deliberate fraud. And the Archaeopteryx fossils came forth in a time and climate where it was very profitable for a forger to invent a fake fossil.[2] Charles Darwin’s book, The Origin of Species, was becoming increasingly popular and many were eager for evidence of evolution. Indeed, it was about this time that the German scientist Ernst Haeckel doctored embryological evidence in an attempt to promote evolution. The
There are several Archaeopteryx fossils. Only on two of the specimens contain feathers that are obviously seen. Without the feathers, Archaeopteryx would be classified as Compsognathus, the little chicken-sized dinosaur. As to the two specimens with the obvious feathers,
Evidence of a forgery includes instances where the supposedly mating faces of the fossil (the main slab and counterslab) do not mate. The feather impressions are primarily on the main slab, while the counterslab in several places has raised areas that have no corresponding indentation on the main slab. These raised areas, nicknamed “chewing gum blobs,” are made of the same fine-grained material that is found only under the feather impressions. The rest of the fossil is composed of a coarse-grained limestone.[5]
In addition, the imprints of the feathers show a “double strike” where “feather impressions were made twice in a slightly displaced position as the slab and counterslab were pressed together.”[6] And in 1986 an x-ray resonance spectrograph was made of Archaeopteryx and “showed that the finer-grained material containing the feather impressions differed significantly from the rest of the coarser-grained fossil slab.”[7] Chemical analysis further showed that the ‘paste’ differed from the composition of rock in the location where Archaeopteryx was supposed to have been found.[8] And so it appears that a forger has simply taken a Compsognathus fossil and applied wings with a paste in a sort of mold casting.
There are also those who do not believe that Archaeopteryx is a fraud, but contend that it was simply a variety of bird. Indeed, newer models of Archaeopteryx look a lot more like a normal bird.[9] If you eliminate certain evolution-biased assumptions, like assuming a scaly head on Archaeopteryx, what you get is quite normal-looking reconstruction of a bird.[10] It makes a big difference what your bias is when you approach these old fossils.
It should be kept in mind that even if Archaeopteryx were a true creature that is now extinct, there would be no good evidence to suggest that it evolved from any other animal. Its existence alone is not sufficient proof that it evolved. If Archaeopteryx were actually real, what would there be to stop a reasonable-thinking person from supposing that it is simply another (albeit unique) bird made by God as part of a special Creation? It suffers from the same argument weakness as any fossil, that is, that we cannot know with surety its origin. All the evolutionists have to offer is their speculation-fuelled fantasy.
[1] For convincing evidence relating to this, the reader is directed to Walt Brown, In the Beginning, , 7th ed., (
[2] Walt Brown, In the Beginning, 7th ed., (
Cave Men and Other Monkey Business
Fossils are often presented as some of the best evidence for human evolution. But there is a major fallacy in the fossil argument for evolution: how can it be proved that some bones found in the dirt are ancestors of those now living? If old bones are found in the dirt like that, it is not possible to prove they have any relation to modern humans. All evidence provided by fossils is, at best, flimsy and circumstantial.
Artists’ interpretations of so-called Cave Men bones have done a great disservice by creating a false impression in the minds of the general population. The image of a grunting, half-ape pervades the mind of a person when they think of “Cave Men.” This is thanks to evolutionist propaganda tools in the form of artists’ drawings that are deliberately made to appear more on the apish side.
Almost always, the remains found of the so-called transitional forms are very minimal. Ramapithecus was constructed from “a mere handful of jaw and teeth fragments. We now know these fragments were pieced together incorrectly.”[1] The entire Nebraska Man was concocted from a pig’s tooth.[2] The Java Man find was later admitted by its discoverer to be similar to a gibbon (a small, long-armed tree-dwelling ape), and that evidence was suppressed which suggested that they were just apes.[3] The remains of the famous Lucy (in reality probably a tree-climbing monkey), were only 40% complete[4] and “the original Lucy fossil did not include the upper jaw, nor most of the skull, nor hand and foot bones!”[5] These finds are hardly definitive. Once again, evolution plows forward on the steam engine of wishful thinking.
Other times, as in the case of Homo erectus and Neanderthal skulls, the distinct characteristics can all be accounted for in modern humans![6] Only the great strength of the Neanderthals is particularly distinct. “Recent dental and x-ray studies of Neanderthals suggest they were humans who matured at a slower rate and lived to be much older than people today.”[7] It could be that they were humans who were still adjusting to the Earth’s post-Flood conditions (i.e. they were getting smaller). It is likely that humans before the Flood were generally bigger than humans today, since everything else before the Flood seemed to grow bigger. After the Flood, when life spans were still extremely long but rapidly declining, people would have been experiencing a transition phase. Neanderthals were probably people who lived just recently after the Flood.
As was stated above, there is nothing particularly distinct between a modern human’s bones and that of Homo erectus that cannot be accounted for in the modern population. The situation between Homo erectus and modern man is summed up in these words:
leading anthropologists Milford H. Wolpoff (University of Michigan), William S. Laughlin (U. of Connecticut), Gabriel Ward Lasker (Wayne State U.), Kenneth A. R. Kennedy (Cornell), Jerome Cybulski (National Museum of Man, Ottawa), and Donald Johanson (Institute of Human Origins) find the differences between these fossil categories to be so small that they have wondered in print if H. sapiens and H. erectus are one and the same. Fossils classified as H. erectus all share a set of “primitive” traits including a sloping forehead and large brow ridges, yet these all fall comfortably within the range of what are called normal humans today.[8]
Really there is no compelling reason to believe anything other than that the hominid fossils that have been found are either entirely human or entirely monkey. The evolutionists are grasping at straws.
[4] John Morris, Was Lucy an Ape-Man?, retrieved from http://www.icr.org/article/1072/ on
[5] Russell Grigg, Are there apemen in your ancestry?, retrieved from http://www.creationontheweb.com/content/view/127/ on
[6] Marvin L. Lubenow, Bones of Contention A Creationist Assessment of Human Fossils Revised and Updated, (
[8] William Hoesch, BTG 210c - How Coherent Is the Human Evolution Story?, retrieved from http://www.icr.org/article/2820/ on
Dinosaurs
No discussion of evolution versus the gospel would ever be complete without considering the dinosaurs. Yes, dinosaurs did roam this earth, and their remains are not relics of their existence on other worlds from which ours was conglomerated. This outlandish theory is popular among Latter-day Saints who do not know how to handle the dinosaur question. The reasoning used for such an idea is derived from a true teaching, that is, that God used “unorganized matter” to form the earth. However, this does not offer us sufficient evidence with which to base such a wild and desperate theory on. “Unorganized matter” could just as surely mean pure elements in a primal form, such as they appear on the periodic table. This is exactly what Joseph Smith seemed to have taught. He said:
[W]e infer that God had materials to organize the world out of chaos—chaotic matter, which is element…Element had an existence from the time he had. The pure principles of element are principles which can never be destroyed. They may be organized and reorganized, but not destroyed.[1]
The world was organized from pure elemental matter, not chunks and large sections of other planets. Therefore, let us first assume that the animal remains we find on this planet are indigenous to it.
Were dinosaurs ever on Noah’s
There is very interesting evidence which suggests that man and dinosaurs inhabited the earth at the same time. In the
The reader is probably thinking, “If dinosaurs co-existed with man, the dinosaurs would have eaten everyone and destroyed civilization!” But if the reader thinks for a moment, they will remember that dangerous animals generally do not cohabit with humans anyway. Few people live right next door to a ferocious bear; that is because people live in communities and bears live in the woods. As people settle an area and tame the land, the dangerous animals are driven out or killed so they do not interfere with human activity. Even dangerous animals will generally keep out of the way of humans intentionally. Of course, there might have been run-ins now and then, just as we might have today with a bear, a cougar, or a crocodile. If this idea sounds too incredible, it should be remembered that there are many large and dangerous animals alive today – so far they have not succeeded in destroying our civilization.
The Creation was completed in 7000 years, during which time God “made heaven and earth, the sea, and all that in them is,”[5] including the dinosaurs, of course. Why is the idea that dinosaurs were simply a regular part of God’s Creation so hard for so many to accept? It is because ever since the readers (and the author) were children, they were told emphatically that humans and dinosaurs have never coexisted. Why? One reason and one reason only: because evolutionary theory says so. But is that something that can be known, or is that something that has to be believed?
The reader is probably now asking, “If dinosaurs co-existed with man, then why are they not mentioned in scripture?” as though to say that if there really were dinosaurs in the days of the patriarchs, somebody back then would have said something about that amazing fact. Well firstly, why should we expect that the ancients would find it prudent to mention, “Hey, there are dinosaurs!” in the holy scriptures? If the animals were a normal part of their world, there would be no reason to make special mention of them simply in order to convince future generations that they existed with man. Secondly, that being said, there actually is a possible mention of a dinosaur in the scriptures. In Job 40:15-24, when the Lord is having Job consider his power as evidenced in his creations, we hear of an awesome and powerful beast that God refers to as “Behemoth.” It also seems apparent that Job was supposed to be familiar with this creature. The scriptures describe Behemoth this way:
[1] Teachings of the Prophet Joseph Smith, selected and arranged by Joseph Fielding Smith (Salt Lake City: Deseret Book Company, 1976), 350-352, emphasis added.
[2] John Morris, The Paluxy River Tracks, retrieved from http://www.icr.org/article/81/ on

Behold now behemoth, which I made with thee; he eateth grass as an ox. Lo now, his strength is in the navel of his belly. He moveth his tail like a cedar: the sinews of his stones are wrapped together. His bones are as strong as pieces of brass; his bones are like bars of iron. He is the chief of the ways of God: he that made him can make his sword to approach unto him. Surely the mountains bring him forth food, where all the beasts of the field play. He lieth under the shady trees, in the covert of the reed, and fens [marshes]. The shady trees cover him with their shadow; the willows of the brook compass him about. Behold, he drinketh up a river, and hasteth not: he trusteth that he can draw up
Contemporary explanations of the Behemoth creature are inadequate. The LDS Bible Dictionary, p. 620, says it is “possibly the hippopotamus,” however hippopotamuses do not have tails “like a cedar.”[1]
Strangely, the possibility exists of dinosaurs still living today. In the deep African Congo, a mysterious creature known to the locals as mokele-mbembe (meaning “blocker of rivers”), has been reported.[2] Natives with no conception of modern evolutionary theory described a ferocious creature living in their swamps that could only be a long-necked dinosaur. Research expeditions have been made to locate the creature, but because of difficulty with environmental conditions, and the fact that the creature apparently spends most of its time in water, confirmation is difficult to obtain.
Dinosaur bones cannot be millions of years old; soft, stretchy organic tissue has recently been found inside the femur of a Tyrannosaurus Rex.[3] The discovery, which was documented in the peer-reviewed journal Science, was made when the bone was broken open in order to transport it. How could soft tissue still exist after millions of years? “Not only have more blood cells been found, but also soft, fibrous tissue, and complete blood vessels.”[4]
It is time to discard the bias of theories which assume millions of years for these bones, and embrace logical conclusions of evidence. Really, there should be no mystery surrounding the existence of the dinosaurs. Were it not for evolution theory having been concocted, what would have prevented mankind from making the correct conclusion that they are merely ancient, pre-Flood animals who roamed in the time that giants dwelt on the earth?[5]
[2] For more information see David Catchpoole, Mokele-mbembe: a living dinosaur? At http://www.creationontheweb.com/content/view/326, first published in Creation 21(4):24–25
September 1999
[3] Carl Wieland, Still soft and stretchy, retrieved from http://www.creationontheweb.com/content/view/3042/ on
Below is the organic tissue, still soft and stretchy, which was found inside the femur bone of a Tyrannosuarus Rex.

conclusion
Evolution has been examined by this article theologically and been found to fail. It has also been examined scientifically by this article and been found seriously wanting. Evolution is simply not compatible with the gospel. Neither is it scientifically expedient to believe in it. In fact, the author would suggest that it is not even reasonable to believe in evolution. It is scripturally unsound and scientifically unnecessary. So why do some Latter-day Saints accommodate it? Such a thing is tragic because it is so unnecessary to bow to that spurious theory. There is no good basis by which a Latter-day Saint should accept evolutionary theory; there is no good reason to. Not only is it unnecessary, it is destructive to our spirituality and view of reality since it forces us to distrust the scriptures and radically reinterpret them. Joseph Smith taught that “a correct idea of [God’s] character, perfections, and attributes” was essential in order for a person to “exercise faith in God unto life and salvation.”[1] A God that would use evolution is certainly out of character with the God portrayed in the scriptures. Latter-day Saints who accept evolution are therefore hindering their faith and thus in danger of losing their inheritance in the
The theory of evolution ought not to be a source of trouble, confusion, or compromise for Latter-day Saints. Far better to uphold the integrity of the scriptures, for we are warned that “Behold, the scriptures are before you; if ye will wrest them it shall be to your own destruction.”[2] There is sufficient information available to vindicate the scriptures and allow us to retain our beliefs unmodified. So let us accept the truth about the origin of man so that we can and go forward in faith.